<link rel="stylesheet" href="styles.f3b1fba60ec7970c.css">

Data:
Data from: Evidence for amino acid snorkeling from a high-resolution, in vivo analysis of Fis1 tail anchor insertion at the mitochondrial outer membrane

dc.contributor.authorKeskin, Abdurrahman
dc.contributor.authorAkdoğan, Emel
dc.contributor.authorDunn, Cory D.
dc.date.accessioned2025-10-24T10:46:36Z
dc.date.issued2017-12-15
dc.description.abstractProteins localized to mitochondria by a carboxyl-terminal tail anchor (TA) play roles in apoptosis, mitochondrial dynamics, and mitochondrial protein import. To reveal characteristics of TAs that may be important for mitochondrial targeting, we focused our attention upon the TA of the Saccharomyces cerevisiae Fis1 protein. Specifically, we generated a library of Fis1p TA variants fused to the Gal4 transcription factor, then, using next-generation sequencing, revealed which Fis1p TA mutations inhibited membrane insertion and allowed Gal4p activity in the nucleus. Prompted by our global analysis, we subsequently analyzed the ability of individual Fis1p TA mutants to localize to mitochondria. Our findings suggest that the membrane-associated domain of the Fis1p TA may be bipartite in nature, and we encountered evidence that the positively charged patch at the carboxyl-terminus of Fis1p is required for both membrane insertion and organelle specificity. Furthermore, lengthening or shortening of the Fis1p TA by up to three amino acids did not inhibit mitochondrial targeting, arguing against a model in which TA length directs insertion of TAs to distinct organelles. Most importantly, positively charged residues were more acceptable at several positions within the membrane-associated domain of the Fis1p TA than negatively charged residues. These findings, emerging from the first high-resolution analysis of an organelle targeting sequence by deep mutational scanning, provide strong, in vivo evidence that lysine and arginine can "snorkel," or become stably incorporated within a lipid bilayer by placing terminal charges of their side chains at the membrane interface.
dc.description.abstractKeskin_AmpliconSequencingFis1TAA pool of plasmids containing Fis1p TA mutations in a Gal4-sfGFP-Fis1 fusion protein and constructed using degenerate primers was cultured in strain MaV203 for four generations in SC-Trp medium, SC-Ura medium, or SMM-Trp-His medium containing 0 mM, 5 mM, 10 mM, or 20 mM 3-AT. Plasmids present under each culture condition were then recovered from 10 OD600 units of cells. Primers 882 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGTAGAGGATAAGATCCAGAAGGAAAC) and 883 (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATAAGAAATTCGCTTATTTAGAAGTG) were used to amplify the genomic region encoding the Fis1p TA from each plasmid pool. Using the provided PCR products, next-generation, paired-end sequencing was performed by Microsynth (Balgach, Switzerland) on a MiSeq Nano (2x150v2). GZIP-compressed FASTQ files and a commercial sequencing report are found in the associated ZIP file.
dc.description.urihttps://dx.doi.org/10.5061/dryad.j14r5
dc.description.urihttp://dx.doi.org/10.5061/dryad.j14r5
dc.identifier.doi10.5061/dryad.j14r5
dc.identifier.openairedoi_dedup___::34eecde8a72023f208e08f55ecd4581b
dc.identifier.urihttps://hdl.handle.net/20.500.14288/31079
dc.language.isoeng
dc.publisherDryad
dc.rightsOPEN
dc.subjectmitochondrial biogenesis
dc.subjectdeep mutational scanning
dc.subjectmembrane insertion
dc.subjecttail anchor
dc.subjectmitochondrial protein targeting
dc.titleData from: Evidence for amino acid snorkeling from a high-resolution, in vivo analysis of Fis1 tail anchor insertion at the mitochondrial outer membrane
dc.typeDataset
dspace.entity.typeData
local.import.sourceOpenAire

Files

Collections